Biology, 23.01.2020 20:31 Phalanndwachris8740

In a certain lake, would you expect there to be more organisms that are large enough to see or more organisms that are too small for you to see

Answers: 3

Show answers

Another question on Biology

Biology, 21.06.2019 20:00

In addition to seeds, which of the following characteristics are unique to the seed-producing plants? a) sporopollenin b) lignin present in cell walls c) pollen d) use of air currents as a dispersal agent e) megaphylls

Answers: 1

Answer

Biology, 22.06.2019 07:20

Agroup of plant cells was exposed to radiation, which damaged the chloroplasts and caused them to lose function. if the mitochondria were unharmed, what would happen to the overall function of the plant cells? a. the cells would not be able to make food, but would be able to release energy from biomolecules. b. the cells would not be able to replicate dna, but would be able to break down waste. c. the cells would not be able to break down waste, but would be able to replicate dna. d. the cells would not be able to release energy from biomolecules, but would be able to make food.

Answers: 1

Answer

Biology, 22.06.2019 08:00

Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offspring. an incomplete dominance cross is performed between a bird that is homozygous for red feathers and a bird that is homozygous for blue feathers. purple offspring result. then, two of the purple offspring are crossed. according to the punnett square for this cross, how many of the offspring from the second cross will have a feather color that results from incomplete dominance? 1 in 4 2 in 4 3 in 4 4 in 4

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

In a certain lake, would you expect there to be more organisms that are large enough to see or more...

Questions