Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
The more rapidly sedimentation occurs, the more likely it is that the remains will successfully form a fossil. as sedimentation continues, what happens to the amount of weight settling onto the organism? stays the same increases decreases cuts in half
Answers: 2
Biology, 22.06.2019 15:30
When does a spring tide occur? question 9 options: they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur twice a year in the spring and fall. they occur on the date of the vernal equinox each year, no matter what stage the moon is in. this is why they are called spring tides. they occur when the sun, moon, and earth are at 45-degree angles from each other. this happens once every spring. they occur when the sun, moon, and earth are aligned. in spite of their name, these tides occur all year long.
Answers: 2
With respect to normal base pairing when a molecule of dna replicates thymine will most likey pair w...
Computers and Technology, 22.02.2022 20:10
SAT, 22.02.2022 20:20
Mathematics, 22.02.2022 20:20
Social Studies, 22.02.2022 20:20
Mathematics, 22.02.2022 20:20
Chemistry, 22.02.2022 20:20
Mathematics, 22.02.2022 20:20
Mathematics, 22.02.2022 20:20
History, 22.02.2022 20:20