Answers: 1
Biology, 22.06.2019 03:30
Ayoung boy has been found and police are trying to locate his family they take a dna sample from him and begin collec dna samples from families who have missing children if police use dna samples only from the fathers, which type of dn technology can they use to identify the boy's parent? y-chromosome analysis omtdna (mitochondrial dna) analysis vntrs (variable tandem repeats) o pcr (polymerase chain reaction) analysis
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:10
What would most likely happen to a unicellular organism if it was exposed to a hypotonic solution for an extended period of time?
Answers: 1
Biology, 22.06.2019 17:30
According to these anatomical structures which two animals are probably most closely related
Answers: 2
The speech disorder known as is considered to be a receptive aphasia....
History, 21.03.2020 12:00
Mathematics, 21.03.2020 12:00
Computers and Technology, 21.03.2020 12:00
Mathematics, 21.03.2020 12:00
Mathematics, 21.03.2020 12:00
Spanish, 21.03.2020 12:00
Mathematics, 21.03.2020 12:00
Chemistry, 21.03.2020 12:00
Mathematics, 21.03.2020 12:00