![ansver](/tpl/images/cats/User.png)
Answers: 2
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:00
Food provides molecules that serve as fuel and building material for all organisms. plants undergo photosynthesis and make their own food. other organisms, like us and the horse seen above, are consumers and eat food. how do all organisms use food as fuel? be sure to include the name of the process in your answer. me.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:00
Suppose you use three different scale to weigh a bag of oranges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of oranges is 2.153 lb. which of the following best decribes these results?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:40
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population.b) the separated population is small, and genetic drift occurs.c) the isolated population is exposed to different selection pressures than the ancestral population.d) different mutations begin to distinguish the gene pools of the separated populations.e) gene flow between the two populations is extensive.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How do stars luminosity compared with their radii...
Questions
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.01.2020 23:31
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/ekonomika.png)
Business, 27.01.2020 23:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 27.01.2020 23:31
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 27.01.2020 23:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 27.01.2020 23:31
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 27.01.2020 23:31
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 27.01.2020 23:31
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/fr.png)
French, 27.01.2020 23:31