![subject](/tpl/images/cats/biologiya.png)
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:00
Scientists are conducting a study on the effectiveness of a new drug on memory loss. they are giving some of the test subjects the new drug to find out if it improves their long-term memory. which are possible limitations of this study? check all that apply. a) test subjects may want to participate in additional experiments. b) test subjects may think they should be paid more. c) test subjects may get bored and want to quit early. d) test subjects may have to travel during the experiment. e) test subjects may have full-time jobs. this is multiple choice. you for the !
Answers: 2
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:40
Read the article and use the information to answer the questions that follow discovering the structure of dna explain how the discoveries by rosalind franklin watson and crick build an accurate model of dna done
Answers: 2
You know the right answer?
Which sphere of the earth system includes trees grasses and squirrels?...
Questions
![question](/tpl/images/cats/geografiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.10.2019 18:00
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 02.10.2019 18:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 02.10.2019 18:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 02.10.2019 18:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 02.10.2019 18:00
![question](/tpl/images/cats/mat.png)
Mathematics, 02.10.2019 18:00
![question](/tpl/images/cats/mat.png)
Mathematics, 02.10.2019 18:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 02.10.2019 18:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.10.2019 18:00
![question](/tpl/images/cats/istoriya.png)
History, 02.10.2019 18:00