subject
Biology, 27.11.2019 21:31 vnfrancis1353

Ivory from elephant tusks is highly valued for making jewelry and art pieces. because of this, large numbers of elephants were hunted throughout the 1800s and 1900s. by the 1980s, the elephant population in africa had severely decreased and elephants were in danger of extinction. international laws banning the trade of ivory were passed in order to protect elephants from being hunted. how have the laws most likely affected the world’s elephant populations?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:30
Which statements best describe monsoons? check all that apply. they force cool, moist air from oceans to rise. they are winds that blow in the opposite direction of a normal wind. they bring rain in the summer and drought in the winter they increase rainfall in south asia, africa, and australia. they influence precipitation as wind moves near a mountain.
Answers: 1
question
Biology, 22.06.2019 19:00
Agroup of students are walking in the park and one of them takes a picture of a pollen grain that is been blown by the wind what caption can the student use for this picture
Answers: 1
question
Biology, 22.06.2019 19:20
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
You know the right answer?
Ivory from elephant tusks is highly valued for making jewelry and art pieces. because of this, large...
Questions
question
Mathematics, 09.12.2019 03:31
Questions on the website: 13722361