![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:20
Ascientist wants to determine the effect of a new type of gasoline. he fillsone car with normal gasoline and another identical car with the new gasoline.which is the control group? a. the new type of gasolineb. the car with the normal gasolinec. the car with the new gasolinethe amount of gasoline usedd. the amount of gasoline used
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00
In 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? in 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? staphylococcus aureus bacteria that were able to synthesize cell walls using a protein that was not affected by methicillin survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, some bacteria began to synthesize cell walls using a protein that was not affected by methicillin. these bacteria survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, bacterial populations gradually began to synthesize cell walls using a protein that was not affected by methicillin.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
This rapid change in species that rarely leaves behind fossil evidence is referred to as
Answers: 3
You know the right answer?
34. Transfer the following into DNA: ATGTAGCCTACGTATAATGCAā...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 23:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 23:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
English, 14.12.2020 23:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 23:30
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 14.12.2020 23:30
![question](/tpl/images/cats/en.png)
English, 14.12.2020 23:30
![question](/tpl/images/cats/fizika.png)
Physics, 14.12.2020 23:30
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 14.12.2020 23:30
![question](/tpl/images/cats/himiya.png)
Chemistry, 14.12.2020 23:30
![question](/tpl/images/cats/mat.png)
Mathematics, 14.12.2020 23:30