1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Another question on Biology
Biology, 21.06.2019 22:00
Where would you expect to see seedless plants, such as ferns and mosses? a. in a botanical museum, because they are all extinct b. low and close to the ground in a moist environment c. climbing high while circling the branches of another plant d. deeply rooted in a forest with a trunk that reaches 20 meters or more
Answers: 1
Biology, 21.06.2019 22:00
This is one of the five kingdoms in the older biological succession. organisms in this kingdom are prokaryotic
Answers: 2
Biology, 22.06.2019 04:30
The green colored pigment in chloroplasts is? a. nitrogen b. chlorophyll c. chlorophorm d. chlorofloromethane
Answers: 2
You know the right answer?
Questions
Spanish, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Social Studies, 06.11.2020 20:30
Health, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Biology, 06.11.2020 20:30
History, 06.11.2020 20:30
English, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
Mathematics, 06.11.2020 20:30
History, 06.11.2020 20:30
