Acertain segment of dna can be used as a molecular clock. its rate of mutation is one mutation per 20 million years. examine the dna segments from two different species:

species a: gtacctaagttcaccgaatt
species b: gaacctaagggcaccgaact

using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.