Answers: 2
Biology, 22.06.2019 02:30
Many plants can reproduce asexually. which of these is an example of asexual reproduction in a plant? a. pine cones forming on a tree b. cross-pollination in a tomato c. roots sprouting from a potato d. night-blooming jasmine flowers
Answers: 3
Biology, 22.06.2019 07:50
One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails. b. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. c. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails have other functions,because prokaryotes don't have nuclei.
Answers: 3
Biology, 22.06.2019 09:30
Consider the following reaction: 2h2 + o2 —> 2h2o a) what are the reactants in this reaction? b) what are the products in this reaction? c) how many molecules of oxygen are used in this reaction?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
2. Coyotes tend to prey on sheep. How would this cause them to be a persecuted species?
They are pe...
Mathematics, 11.07.2019 22:00
English, 11.07.2019 22:00
Physics, 11.07.2019 22:00
Social Studies, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00
History, 11.07.2019 22:00
Physics, 11.07.2019 22:00
Physics, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00
Mathematics, 11.07.2019 22:00