Fill in the blank to the total energy of a system?
a enthalpy
b heating curve
c entopy
d free energy

Dna is colied into chromosomes in a cell

How do tides affect the organisms living in intertidal zones? a. no organisms live in intertidal zones due to the tumultuous environment. b. the mechanical forces of the waves keeps the organisms clean. c. only plants live in intertidal zones because the animals float away with the waves and never return. d. the mechanical forces of the waves can dislodge the organisms from their habitat.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?