Answers: 2
Biology, 21.06.2019 13:30
Which of the following is not a classification of marine organisms? a. benthos c. neritic b. nekton d. plankton select the best answer from the choices provided a b c d
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:40
What evidence could be used to convince policy makers to change a shipping lane from going through a whale breeding ground? information on the number of all whale species currently alive information on the number of all whales hit by boats in the given area information on the number of whale deaths in the world's oceans information on the number of whale offspring born every year. (a) scientists could collect and combine data on fish populations all around the world to show that their populations are declining. (b) scientists collect and combine data on fish populations all around the world to show that their populations are increasing. (c) scientists work together and use past data to show that fish populations are becoming locally extinct in some areas. (d) scientists work together and use past data to show that some fish populations are adapting to environmental changes.
Answers: 1
Biology, 22.06.2019 19:30
When mitochondrial dna from living relatives was compared with mitochondrial dna from the skeletons, scientisits determined that skeletons 3,4,5,6 and 7 were members of the romanov family. which of these skeletons can be identified by name based on the evidence you have? explain your answer.
Answers: 2
What does bilious mean....
Mathematics, 05.12.2020 01:00
Biology, 05.12.2020 01:00
Chemistry, 05.12.2020 01:00
English, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
English, 05.12.2020 01:00
Business, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
History, 05.12.2020 01:00
English, 05.12.2020 01:00
Mathematics, 05.12.2020 01:00
English, 05.12.2020 01:00
History, 05.12.2020 01:00
History, 05.12.2020 01:00