Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence...
Biology, 30.03.2021 16:20 psychocatgirl1
Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACTT
Complementary DNA #3:
Answers: 2
Biology, 22.06.2019 08:10
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
Biology, 22.06.2019 11:30
Which of the following is an eon in the time scale? phanerozoic proterozoic archean all of the above
Answers: 2
Biology, 22.06.2019 13:20
Imagine a self-reactive t cell that has not undergone clonal deletion in the thymus (that is to say, it has escaped central tolerance). if it encounters self antigen in the absence of an infection or inflammation, what will happen to this self-reactive t cell? (select two answers) (a) the t cell undergoes clonal expansion. (b) the t cell gains effector functions. (c) the t cell undergoes apoptosis. (d) the t cell becomes activated. (e) the t cell becomes anergic.
Answers: 1
Health, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Social Studies, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00
Mathematics, 29.01.2021 03:00