Biology, 29.03.2021 20:10 Staceyrycz2772
Recently, the Supreme Court of the United States reversed a lower court ruling that allowed a company to patent DNA sequences for two cancer genes. The patent prevents other scientists from using these DNA sequences for any reason. The company uses the DNA sequences to market kits used to identify the two types of cancer in humans. The company claims that the gene sequences are its intellectual property. Its owner feels that allowing other people access to the sequences will harm his company financially because the search for the gene sequences was very expensive. But the plaintiff in the case argued that gene sequences are products of nature and cannot legally be patented. The plaintiff explained to the judge that the kits are very expensive. As a result, some patients who need these tests cannot afford to have them done. The plaintiff also pointed out that allowing a company to patent DNA sequences denies other scientists the ability to study the sequences. The Supreme Court agreed with the plaintiff and sent the case back to the lower court to be reviewed.
After you have read the passage on the left, identify the statement that summarizes the main concern of the defendant.
The company will be unable to benefit from the hard work of its scientists.
The DNA sequences might be lost
The defendant is worried that allowing access to the sequences will encourage someone to create mutations.
The patent limits the sharing of important scientific knowledge
Answers: 1
Biology, 22.06.2019 11:30
Female luna moths (actias luna) attract males by emitting chemical signals that spread through the air. a male hundreds of meters away can detect these molecules and fly toward their source. the sensory organs responsible for this behavior are the comblike antennae visible in the photograph shown here. each filament of an antenna is equipped with thousands of receptor cells that detect the sex attractant. based on what you learned in this chapter, propose a hypothesis to account for the ability of the male moth to detect a specific molecule in the presence of many other molecules in the air. what predictions does your hypothesis make? design an experiment to test one of these predictions.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:50
Babies with very low or very high birth weight are less likely to survive. observe a graph of the data. % babies born at different weights % babies born in that category 6.0 6.5 in 50-555 70-75 80-8511 100-1055 which statement is a valid claim that could be made using the data in the graph? directional selection is occurring because the graph favors an extreme. mark this and retum save and exit next submit o type here to search
Answers: 2
Recently, the Supreme Court of the United States reversed a lower court ruling that allowed a compan...
Mathematics, 18.03.2020 01:17
English, 18.03.2020 01:17
Law, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18
Business, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18
Mathematics, 18.03.2020 01:18