18
7
1 point
Given the DNA template strand below type the complementary mRNA that would...
![subject](/tpl/images/cats/biologiya.png)
Biology, 26.03.2021 18:30 starfox5454
18
7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
What is the correct order of cell division? include what happens in each phase
Answers: 2
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 23:30
In the classification system this is a group of organisms with one or more related species
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 23.06.2019 02:00
Amembrane protein is made and inserted into the membrane of the rough endoplasmic reticulum. a binding site that is present in this protein is aligned so that it faces the lumen of the er. if this protein is then moved to other endomembranes, at which surface of the membranes given below is this binding site unlikely to be found? a. internal face of the golgi apparatus membranes b. the internal face of lysosome membrane c. facing the intermembrane space of the nuclear envelop membranes d. the lumen face of the vesicle just derived from the golgi apparatus e. the cytosolic face of the plasma membrane
Answers: 3
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
English, 20.05.2021 19:00
![question](/tpl/images/cats/istoriya.png)
History, 20.05.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/istoriya.png)
History, 20.05.2021 19:00
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 20.05.2021 19:00