18 7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...

Amembrane protein is made and inserted into the membrane of the rough endoplasmic reticulum. a binding site that is present in this protein is aligned so that it faces the lumen of the er. if this protein is then moved to other endomembranes, at which surface of the membranes given below is this binding site unlikely to be found? a. internal face of the golgi apparatus membranes b. the internal face of lysosome membrane c. facing the intermembrane space of the nuclear envelop membranes d. the lumen face of the vesicle just derived from the golgi apparatus e. the cytosolic face of the plasma membrane