Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt
tacgcgacgtgcacgtgcaa

This is a typical grassland food web. it is also a small picture of an important cycle on earth: the carbon cycle. describe how the carbon gets into this food web. a) bacteria and fungi, the decomposers, recycle carbon from dead organisms. b) carbon is found in the grass and is passed from one level to the next in this food web. eliminate c) all living things give off carbon dioxide as a by-product of respiration and it is released into the atmosphere. d) plants use carbon dioxide as a reactant in photosynthesis, to make usable chemical energy in the form of a sugar.