![subject](/tpl/images/cats/biologiya.png)
*25 points* Will give brainliest!
Gabriel’s family wants to understand what causes red-green colorblindness. You explain that in individuals with normal color vision the genes OPN1LW and OPN1MW provide instructions for making proteins called opsins. Opsins are found in the retina of the eye and are involved in color vision. If mutations occur in these genes, opsin proteins may function abnormally, possibly resulting in colorblindness.
Read each of the statements that describe how the opsin genes and proteins are different or the same in individuals with normal vision or colorblindness. Drag each statement into the correct box.
Normal DNA sequence Mutated DNA sequence Produces normal opsins Produces abnormally functioning opsins Colorblind individual
Normal color vision individual
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30
What were the main components of earth’s earliest atmosphere? oxygen and ammonia hydrogen and helium oxygen and nitrogen hydrogen and nitrogen
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Matched chromosomes carrying information about the same characteristics in the organism are called
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 17:10
Question 17 (1 point) where does penicillin come from? a. it is a chemical that man invented b. it is a fungus c. it is a toxin made by other bacteria d. it was discovered in archaebacteria
Answers: 1
You know the right answer?
*25 points* Will give brainliest!
Gabriel’s family wants to understand what causes red-green colorb...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:40
![question](/tpl/images/cats/biologiya.png)
Biology, 25.04.2021 15:40
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:40
![question](/tpl/images/cats/en.png)
English, 25.04.2021 15:40
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:40
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:40
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:40
![question](/tpl/images/cats/biologiya.png)
Biology, 25.04.2021 15:50
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:50
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:50
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:50
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.04.2021 15:50
![question](/tpl/images/cats/mir.png)
World Languages, 25.04.2021 15:50