1.What is a codon? What does it tell the ribosome? 2.What are amino acids?
3.How does a ribosome know when a protein strand should start producing and when it should stop adding amino acids?
4.Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA

1. A codon is a triplet of nucleotides that codes for an amino acid. This amino acid is transported by the tRNA which possesses a complementary anticodon and it gets added to the nascent protein.

2. Amino acids are organic compounds that contain amino (–NH2) and carboxyl (–COOH) functional groups, along with a side chain (R group) specific to each amino acid.

3. the onset of protein production is signaled by the AUG codon which encodes methionine. the stop to the synthesis is given instead by the stop codons (UAA, UAG, UGA)

4. Met-Val-Thr-Ser-Arg-Leu-Stop

structure is maintained and sustained by:

-cytoskeleton: gives cells coherence

-cell wall: support

-cytoplasm: shape

hope this .

b exhibiting favoritism toward the kikuyu people.