![subject](/tpl/images/cats/biologiya.png)
Biology, 11.03.2021 14:00 tjacqueline9753
What is the proper sequence for an mRNA molecule made form the following segment of DNA? AGTTGA
1. AGTTGGA
2. UCAACU
3. TCAACT
4. TCUUCT
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:30
Which of the following is one of the four conditions necessary for natural selection to occur in a population? fewer organisms are born than the habitat can support mutation does not occur organisms have identical characteristics variation is inherited
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00
Which soil would most likely be found in the arctic? andisols gelisols histosols spodosols
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30
Math focus 4. calculate a map has index contours at 250 m, 500 m, and 750 m. what is the contour interval?
Answers: 3
You know the right answer?
What is the proper sequence for an mRNA molecule made form the following segment of DNA? AGTTGA
1....
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/biologiya.png)
Biology, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/mat.png)
Mathematics, 25.03.2021 19:00
![question](/tpl/images/cats/istoriya.png)