Please help me The DNA base sequence for a short gene is
TATGATACCTTGATAGCTATGTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use the genetic code chart below and your knowledge of
transcription and translation to figure out the message?

1. amino acid refers to the fundamental building block of proteins, comprising of an amino group and a carboxyl group.

2. catalyst refers to any substance, which increases the rate of chemical reaction without being used up in the reaction.

3. a complex molecule containing he genetic code is dna or deoxyribonucleic acid.

4. an enzyme refers to a molecule of protein, which is unique in accelerating up a particular chemical reaction in the biological systems.

5. nucleic acid refers to an sequence of sugars, phosphates, and nitrogenous bases, for example, dna and rna.

6. a protein refers to a large, composite organic molecule comprising of a huge number of amino acids associated together with the of peptide bonds.

7. rna refers to a nucleic acid that takes part in the production of proteins.

8. substrate refers to a compound, which takes part in a chemical reaction, and is chemically modified by the reaction.