subject
Biology, 10.03.2021 08:00 aide1234564

Help fast with homework​


Help fast with homework​

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 21:20
How is mitosis different in plants and animals? a. in animals, the cell membrane pinches together. b. in plants,the dna is one circular chromosomes. c. in plants, there are no sister chromatids. d. in animals, a new cell wall forms.
Answers: 2
question
Biology, 21.06.2019 22:00
Which statement best describes the relationship between an allele and a gene? question 1 options: an allele is a variation of a gene that can be expressed as a phenotype. an allele is the part of a gene that attaches to messenger rna molecules. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
question
Biology, 22.06.2019 09:30
Which statement names a physical property of wood? wood does not rustwood can burnwood can rotwood is softer than coal
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Help fast with homework​
...
Questions
question
Mathematics, 09.09.2020 01:01
question
Social Studies, 09.09.2020 01:01
question
Biology, 09.09.2020 01:01
question
Mathematics, 09.09.2020 01:01
question
Mathematics, 09.09.2020 01:01
question
Mathematics, 09.09.2020 01:01
Questions on the website: 13722367