subject
Biology, 09.03.2021 04:40 dcox0306

Please Help me One of the symptoms of high salt concentrations in soil is plants that appear dehydrated even when they are receiving adequate water. How can you explain this phenomena using what you observed in the root cells of the salt-sensitive plants?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 20:00
Ineed to know why d is the correct answer asap
Answers: 1
question
Biology, 22.06.2019 10:30
In what cells is the human genome located?
Answers: 1
question
Biology, 22.06.2019 11:00
Which of the following forest management practices is best for reestablishing areas of forest?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Please Help me One of the symptoms of high salt concentrations in soil is plants that appear dehydr...
Questions
question
Mathematics, 17.12.2020 19:30
question
Mathematics, 17.12.2020 19:30
question
Mathematics, 17.12.2020 19:30
Questions on the website: 13722367