subject
Biology, 05.03.2021 19:00 kswaggish101

Which of the following principles is NOT part of the theory of evolution by natural selection? Evolution is a gradual process that occurs over long periods of time.
O Mutations to genes are dangerous in populations and always lead to non-advantageous traits.
O Individuals that possess the most favorable variations have the best chance of reproducing.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 07:30
9. the history of life on earth is recorded in
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 16:30
As a result of climate change earths temperature is rising and sea ice is melting what is a likely effect? answer : populations of walruses and polar bears will decline
Answers: 1
question
Biology, 22.06.2019 19:20
3. in the fruit fly, recessive mutation brown, b, causes brown color of the eye and absence of red pigment. recessive mutation p of another independent gene causes purple color of the eye and absence of brown pigment. the cross of a brown-eyed female and purple-eyed male produced wild type eyes. what will be the colors and their ratio in f2?
Answers: 2
You know the right answer?
Which of the following principles is NOT part of the theory of evolution by natural selection? Evol...
Questions
Questions on the website: 13722360