![subject](/tpl/images/cats/biologiya.png)
Biology, 01.03.2021 01:50 garcser257278
Using the codon chart or wheel above, translate the following mRNA strand into an amino acid sequence: (Write out the full name of the amino acid, as seen in the chart with all capital letters.) UAC | GCC | AUG | GGU | CGA | UUA |CCC | AAC | UCA | UGA | GUG | ACU​
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 20:30
According to the big bang theory, after the "bang," the universe remained dark until about 300,000 yearsone billion yearsthree minutesthree billion years later, when neutral atoms began to form.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:00
How do temperature and salinity affect deepwater currents? they create changes in wind direction, moving denser water in the same direction as the wind and causing the deepwater circulation patterns found in the ocean. as temperatures and salinity levels of water increase, the water rises to the surface where it creates currents as it moves to colder regions. they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them. they equalize the forces on undersea currents caused by the coriolis effect as they replace more dense water with less dense water.
Answers: 1
You know the right answer?
Using the codon chart or wheel above, translate the following mRNA strand into an amino acid sequenc...
Questions
![question](/tpl/images/cats/ekonomika.png)
Business, 11.07.2019 21:00
![question](/tpl/images/cats/geografiya.png)
Geography, 11.07.2019 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 11.07.2019 21:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/istoriya.png)
History, 11.07.2019 21:00
![question](/tpl/images/cats/biologiya.png)
Biology, 11.07.2019 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 11.07.2019 21:00
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 11.07.2019 21:00
![question](/tpl/images/cats/en.png)
English, 11.07.2019 21:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
English, 11.07.2019 21:00
![question](/tpl/images/cats/mat.png)
Mathematics, 11.07.2019 21:00
![question](/tpl/images/cats/himiya.png)
Chemistry, 11.07.2019 21:00
![question](/tpl/images/cats/istoriya.png)
History, 11.07.2019 21:00