subject
Biology, 28.02.2021 06:00 pablogamohunndo

Temperature and pressure changed both the affect the strength of a storm. As a hurricane approaches land, what would most likely decrease the storms strength? A: average air currents
B: more humidity
C: cooler temperatures
D: warmer water

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:30
Sexual reproduction in the parent cell will result in offspring with a) identical genetic information. b) half the genetic information. c) double the genetic information. d) four times the genetic information.
Answers: 1
question
Biology, 22.06.2019 06:20
What makes a dominant allele different from a recessive allele
Answers: 2
question
Biology, 22.06.2019 09:30
What's wrong with this ecological pyramid? (multiple choice)1. secondary consumers should be at the bottom of the pyramid2. the sun has an arrow leading to decomposers 3. primary consumers should come after the sun4. energy retained should increase from the bottom to the top5. the sun should be at the bottom of the pyramid
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Temperature and pressure changed both the affect the strength of a storm. As a hurricane approaches...
Questions
question
History, 10.08.2021 14:00
question
Social Studies, 10.08.2021 14:00
question
English, 10.08.2021 14:00
Questions on the website: 13722363