Biology, 22.02.2021 02:10 jayonelijah
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore gloves, a hat, and a bandana that covered his face. A security guard attempting to stop the robber was knocked unconscious in a struggle. However, the guard managed to pull the hat from the robber's head. Witness accounts and security tapes led police to arrest three possible suspects. None of the suspects have alibis, but police are not certain which man is the robber. Using hair samples from the hat recovered by the security guard, the crime lab did a Southern Blot test. Hair samples were also taken from each suspect. Use the suspects' hair samples to determine the guilty party.
Part Two
Copy the DNA sequences for each suspect into a Word document.
Use your special enzyme to cut each sequence at the forward slash marks (/). (You can do this by putting spaces after each slash mark.)
Arrange the DNA cuttings in order from shortest to longest. Attach them to a special piece of nitrocellulose paper (construction paper).
Compare the probe base pair sequence with a DNA sample taken from Suspect A. Use a highlighter or different color font to mark any sequences that match the probe.
Repeat step 1 with the DNA samples for Suspects B and C.
Suspect A
TCCATCCA / TCCATCCATCCA / TCCA / GGCTTACCTATAAGG / TGGATGGATGGATGGATGGA
Suspect B
TCCATCCA / TCCATCCAATTG / TCCA / TCCATCCATCCATCCATCCA / TGGATGGATGGATGGA
Suspect C
TTAGCTA / CCGGTATGA / AGGT / CGTTATCGGATATA / GGTTAGGACCTATCGATAGA
Probe
AGGT
Questions
Answer these following questions in the essay box below.
Which suspect most likely committed the robbery?
How do you know?
Answers: 3
Biology, 22.06.2019 06:30
Is there any solid scientific evidence that humans have been cloned?
Answers: 1
Biology, 22.06.2019 07:00
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
Biology, 22.06.2019 18:30
Crinoids, also known as sea lilies, appear to be sea plants but are not plants at all. crinoids are an echinoderm species which uses anchoring structures called holdfasts to attach themselves to the sea floor. crinoids were most abundant in pennsylvania during the mississippian period, which ranged from 375 to 320 million years ago. fossils of the crinoids shows that during most of this time pennsylvania was that provided favorable conditions for crinoid growth. a) glacial terrain b) a dry and sandy plain c) mostly mountain ranges d) covered by warm, shallow seas
Answers: 2
Biology, 22.06.2019 21:30
Adaptive radiations can be a direct consequence of four of the following five factors. selectthe exception. a) vacant ecological niches b) genetic drift c) colonization of an isolated region that contains suitable habitat and few competitor species d) evolutionary innovation e) an adaptive radiation in a group of organisms (such as plants) that another group uses as food
Answers: 1
Case #28104
Last month, Hudson National Bank was robbed by an unidentified man. The robber wore glo...
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
History, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Health, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
Mathematics, 08.11.2019 02:31
English, 08.11.2019 02:31