Biology, 21.02.2021 21:20 klivingston1012
Plz help! What is the specific function of signal cells releasing chemical messages to nearby cells during early embryonic development?
The chemical messages will impact the cells, resulting in change to gene expression.
The chemical messages will facilitate the transfer of mRNA.
The signaling cells will initiate programmed cell death in nearby cells.
The signaling cells will prevent DNA mutation in nearby cells.
Answers: 3
Biology, 22.06.2019 03:00
The unique structure of the neuron is dedicated to the efficient and rapid transmission of neural signals. the relationship between neurons, the spinal cord, and the brain constitutes an elaborate communication system throughout the human body. all but one of the functions listed below are a result of this interaction.
Answers: 1
Biology, 22.06.2019 05:30
Diego conducted an experiment to find out what kind of ball bounces the highest when dropped from a five-foot platform. he used a golf ball, a tennis ball, and a soccer ball. he dropped each ball from the balcony once. diego recorded his observations after each drop. what can diego do to best improve the reliability of his results? a) drop each ball from the platform three more times b) record his observations in more than one unit c) write at least two scientific questions after the experiment is complete d) share his results with other people who have done similar experiments you for the !
Answers: 1
Biology, 22.06.2019 09:30
Drag each tile to the correct box. the body monitors the levels of oxygen in the blood to regulate breathing. isabel is running in a marathon and is near the finish line. she feels out of breath. how will her nervous system work to generate a reaction? arrange the tiles in chronological order. isabel's breathing rate increases. sensory receptors in the arteries detect low oxygen levels. the brain sends signals through motor neurons. sensory neurons generate an impulse. the central nervous system relays an impulse to certain brain regions.
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Plz help! What is the specific function of signal cells releasing chemical messages to nearby cells...
Computers and Technology, 24.03.2020 01:52
Business, 24.03.2020 01:52
Mathematics, 24.03.2020 01:52
Biology, 24.03.2020 01:52
Mathematics, 24.03.2020 01:52