subject
Biology, 19.02.2021 03:20 fubowangkevin

When can listening become active? ​

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 14:50
What must happen before meiosis can begin? a. four gametes must be produced b. the four tetrads must be pulled apart c. dna doubles and produces sister chromatids d. the cell membrane pinches together
Answers: 1
question
Biology, 21.06.2019 16:40
Some plants rely on the wind to reproduce an example is it’s important for plants to use the forces of nature to reproduce because 1. 1a white tuft of dandelion seeds 2a spiked burrs surrounding seeds 3a hard shell on a walnut? 2. 1b require pollination to reproduce 2b reproduce only asexually 3b cannot move about freely?
Answers: 3
question
Biology, 22.06.2019 03:30
Rease is an enzyme used by plants to break down urea (a nitrogen-containing compound) into carbon dioxide and ammonia. urease urea > > > carbon dioxide and ammonia ammonia is broken down by plants into a nitrogen source plants need to grow. thus, plants could not use urea as a nitrogen source unless it was first converted to ammonia. in soybean plants there are two different kinds of urease, one produced in the seeds and the other produced in the leaves of the plant. three types of soybean plants were used in a set of experiments: normal soybeans and two mutant strains, one lacking the urease in the seeds only (strain 1) and one lacking urease in the leaves only (strain 2). experiment 1 separate areas in a field were planted with normal, strain 1, and strain 2 soybeans. all types of soybeans appeared to grow, flower, and produce seeds equally well. there were no externally detectable differences among the strains. experiment 2 small pieces of plant leaves of equal weight were obtained from each type of soybean plant and separately placed on media in culture dishes. tissue growing in this way will become an unorganized clump of cells referred to as callus. to provide a controlled nitrogen source, half the tissue samples of each type were placed on media containing urea, and the other half of the samples were placed on media containing ammonia. after 30 days, the weight gain for each of the callus samples was determined. results are shown in the table below.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
When can listening become active? ​...
Questions
question
Mathematics, 29.01.2021 01:00
question
Computers and Technology, 29.01.2021 01:00
question
Mathematics, 29.01.2021 01:00
question
Arts, 29.01.2021 01:00
question
Mathematics, 29.01.2021 01:00
question
Mathematics, 29.01.2021 01:00
question
Mathematics, 29.01.2021 01:00
question
Health, 29.01.2021 01:00
Questions on the website: 13722363