Biology, 18.02.2021 06:10 jwood287375
(VIRUS AND BACTERIA) Fill the blanks 15. are just composed of RNA without a capsid 16. are infectious proteins that transform other proteins into more prions
Answers: 3
Biology, 21.06.2019 23:00
Which of the following is not a defining characteristic of plants?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
The embryos of a bird, a reptile, and a mammal are similar in appearance. how does comparing the physical appearance of embryos of different species support the theory of evolution? a. it shows that these organisms share a common ancestor. b. it provides evidence that these organisms eat the same foods.c. it shows that these organisms share the same habitat.d. it provides evidence that these organisms suffered a genetic mutation.
Answers: 1
Biology, 22.06.2019 13:10
Once an egg cell is fertilized by sperm, the cell then, as the embryo develops, it receives nourishment and eliminates wastes by transferring substances from its blood to its mother's blood. a. becomes a fetus immediately and exits the womb b. begins to divide and implants itself in the wall of the uterus c. remains in the uterus without dividing for several months d. travels back to the ovaries until the fetus is developed
Answers: 2
(VIRUS AND BACTERIA) Fill the blanks
15. are just composed of RNA without a capsid 16. are infecti...
Mathematics, 01.12.2020 21:10
Mathematics, 01.12.2020 21:10
English, 01.12.2020 21:10
Law, 01.12.2020 21:10
Chemistry, 01.12.2020 21:10
Mathematics, 01.12.2020 21:10
Mathematics, 01.12.2020 21:10
Social Studies, 01.12.2020 21:10
Social Studies, 01.12.2020 21:10
Mathematics, 01.12.2020 21:10