How are nucleotide monomers combined

What sentence best supports the statement that hormones are involved in the regulation of homeostasis? a. the hormone erythropoeitin increases the production of red blood cells when oxygen levels are low. b. the hormone oxytocin promotes labor contractions of the uterus during childbirth. c. the hormone melatonin induces sleep and its production is slowed by exposure to light. d. the hormone cortisol suppresses the immune system and is produced when the body is under stress.

In what cells is the human genome located?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?