subject
Biology, 02.02.2021 23:40 RaquelLWhite

What's glucose A. organic molecules that store energy in their chemical bonds
B. The energy carrying molecule that cells use for energy
C. Stores chemical energy in a concentrated stable form
D.

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 03:30
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
question
Biology, 22.06.2019 08:50
Blood stem cells may develop into any kind of human blood cells. what kind of stem cells are blood stem cells? a. multipotent stem cells o b. totipotent stem cells o c. pluripotent stem cells o d. unipotent stem cells
Answers: 1
question
Biology, 22.06.2019 09:40
Which statement is the best summary of the model? a-a series of aerobic and anaerobic reactions take place in cells b- the sun's energy moves through trophic levels in a food chain c-light energy is converted into stored chemical energy plants.d- food molecules are broken down in the cells if living things.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What's glucose A. organic molecules that store energy in their chemical bonds
B. The energy c...
Questions
question
Spanish, 07.09.2020 07:01
Questions on the website: 13722367