subject
Biology, 29.01.2021 09:00 aliviafrancois2000

Can someone help me on this science question please for brainliest.


Can someone help me on this science question please for brainliest.

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 16:30
Which best explains why viruses do not have special structures or enzymes that allow them to make their own food? viruses can use energy in living cells that they infect. viruses can replicate inside a host that they infect. viruses can cause contagious illnesses in host cells. viruses integrate their rna or dna into infected cells.
Answers: 1
question
Biology, 21.06.2019 19:10
What are the types of mutations, and how does each alter the encoded protein? college level answer
Answers: 1
question
Biology, 22.06.2019 09:30
Natural resources are any materials that humans obtain from the earth to meet our wants and needs.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Can someone help me on this science question please for brainliest.
...
Questions
question
Mathematics, 03.02.2021 20:10
question
History, 03.02.2021 20:10
question
Mathematics, 03.02.2021 20:10
question
Mathematics, 03.02.2021 20:10
question
Mathematics, 03.02.2021 20:10
Questions on the website: 13722359