2
DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

What evidence could be used to convince policy makers to change a shipping lane from going through a whale breeding ground? information on the number of all whale species currently alive information on the number of all whales hit by boats in the given area information on the number of whale deaths in the world's oceans information on the number of whale offspring born every year. (a) scientists could collect and combine data on fish populations all around the world to show that their populations are declining. (b) scientists collect and combine data on fish populations all around the world to show that their populations are increasing. (c) scientists work together and use past data to show that fish populations are becoming locally extinct in some areas. (d) scientists work together and use past data to show that some fish populations are adapting to environmental changes.