subject
Biology, 15.01.2021 19:20 mbonilla073

When a cow is cloned to make exact copies of the adult cow, what is this called? A) embryonic cloning
B) therapeutic cloning
C) SCNT

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 05:40
Benito is doing research on the effects of florida's elevation on its climate. his notes include the following: 1. the average elevation of florida is 30 m above sea level. 2. the highest point in florida is britton hill, which is 105 m above sea level. 3. the change in temperature from 0 m to 1,000 m is 7 °c. what can benito conclude about the effects of florida's elevation on its climate? a.) florida typically experiences cold temperatures and temperature changes within a narrow range. b.) florida typically experiences cold temperatures and temperature changes within a broad range. c.) florida typically experiences warm temperatures and temperature changes within a narrow range. d.) florida typically experiences warm temperatures and temperature changes within a broad range.
Answers: 1
question
Biology, 22.06.2019 06:30
What are they five steps of cloning?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 22:30
Label the offspring chromosomes a1, a2, b1, or b2. circle any mutation chromosomes.
Answers: 3
You know the right answer?
When a cow is cloned to make exact copies of the adult cow, what is this called? A) embryonic cloni...
Questions
question
Biology, 12.10.2019 22:30
question
Mathematics, 12.10.2019 22:30
question
English, 12.10.2019 22:30
question
Mathematics, 12.10.2019 22:30
question
Chemistry, 12.10.2019 22:30
Questions on the website: 13722362