![subject](/tpl/images/cats/biologiya.png)
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.
AUUUAACUGUUCUGUCUAGAG
1.
Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?
2.
Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.
3.
Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.
![ansver](/tpl/images/cats/User.png)
Answers: 3
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:10
Why does meiosis produce cells with half the chromosomes? o a. most of the chromosomes are not necessary to keep an organism alive. b. a gamete needs only half the number of chromosomes because two gametes join together. o c. it makes the gametes easier to move around in the organism. o d. it is faster to produce gametes with fewer chromosomes.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:00
Which statement describes john tuzo wilson’s contribution to the theory of plate tectonics?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 01:30
Scenario 5 1) take 10 red and 10 black beans and place them, mixed, on the table. record the starting phenotype # and frequencies (% of your total population) of your starting population in the table provided (generation 0). 2) act as a predator. “capture” as many organisms as you can until you have reduced the population to three organisms. put them aside. at this point, the predators die. 3) the remaining organisms each produce 2 clonal offspring. multiply your organisms accordingly and allow them to mix on the table. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 1). 4) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 2). 5) repeat the reproduction event, allowing each of your organisms to produce 2 clonal offspring. calculate and record the resultant phenotype # and frequencies (% of your total population) of your population in the table provided (generation 3).
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 02:30
Actinobacteria sp. are fermenting organisms (which do you use oxygen to breathe) referred to as chemoorganohetereotrophs this means they break down organic material and convert it to inorganic material. which part of the carbon cycle does this describe
Answers: 1
You know the right answer?
Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 01.12.2020 01:30
![question](/tpl/images/cats/es.png)
Spanish, 01.12.2020 01:30
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 01.12.2020 01:30
![question](/tpl/images/cats/mat.png)
Mathematics, 01.12.2020 01:30
![question](/tpl/images/cats/mir.png)
![question](/tpl/images/cats/istoriya.png)
History, 01.12.2020 01:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 01.12.2020 01:30