Biology, 12.01.2021 19:40 lillysiege
Which statement is true of both mitosis and meiosis
1.) both are involved in asexual reproduction
2.) both occur only in reproductive cells
3.) the number of chromosomes is reduced by half
4.) DNA replication occurs before the division of the nucleus
Answers: 2
Biology, 21.06.2019 22:00
According to piaget, children have acquired the cognitive skill of conservation when they're able to a. understand that six ounces of liquid in a jar and six ounces in an elongated tube are equal. b. understand the viewpoint of other people. c. relate objects around them to their own needs. d. realize that the term heavy describes an object one way and the term big describes it another way. it is not b nor c. did this 2 x wrong..
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:20
Abiologist counts the number of rabbits in a population each year and observes a decrease in population. since the coyote population has exploded, the biologist concludes that the coyote population has had a negative interaction with the rabbit population. which describes the biologist’s actions? a.) experimentationb.) inferencec.) observationd.) interacting
Answers: 1
Biology, 22.06.2019 16:00
Why were the results whit just water so much different than the trials with the detergent ?
Answers: 3
Which statement is true of both mitosis and meiosis
1.) both are involved in asexual reproduction <...
Mathematics, 21.09.2020 14:01
Mathematics, 21.09.2020 14:01
Social Studies, 21.09.2020 14:01
Mathematics, 21.09.2020 14:01
Mathematics, 21.09.2020 14:01
Computers and Technology, 21.09.2020 14:01
English, 21.09.2020 14:01
Spanish, 21.09.2020 14:01
Mathematics, 21.09.2020 14:01
Mathematics, 21.09.2020 14:01