subject
Biology, 11.01.2021 07:10 Bra1nPowers

What is the mass of an object if the volume is 50mL and the density is 5.3g/mL?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:30
Areal dna molecule consists of thousands of these pairs of nucleotides. what is the pairing arrangement of the nitrogen bases
Answers: 1
question
Biology, 22.06.2019 08:50
Why is earth's outer core hotter than earth’s oceanic crust? earth’s oceanic crust is denser than earth’s outer core is. earth’s oceanic crust has lava flowing from the mantle. earth’s outer core has a composition of solid iron and nickel. earth’s outer core is deeper within earth than oceanic crust is.
Answers: 1
question
Biology, 22.06.2019 09:00
The current thought on the structure of the cell membrane is: a. a static phosphate sandwich of lipids b. a fluid-mosaic of phospholipids and proteins c. a bilayer of proteins with static lipid molecules d. an impermeable bilayer of protein molecules e. a static and permeable phospholipid single layer
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the mass of an object if the volume is 50mL and the density is 5.3g/mL?...
Questions
question
Mathematics, 25.05.2021 20:20
question
Mathematics, 25.05.2021 20:20
question
Mathematics, 25.05.2021 20:20
Questions on the website: 13722360