Biology, 06.01.2021 22:40 janiyaf8941

I'm a boy and have questions for the girls so here's my list. why r u girls so thicc.???
if there is over 100+ genders why only blame men.
Why are u girls complicated.
And why are u girls smarter then boys.
and why are you girls so mean.
And also if you say periodttt you deserve to be run over by a truck.

Answers: 2

Show answers

Another question on Biology

Biology, 21.06.2019 15:30

Secondary pollutants are more harmful than primary pollutants. select the best answer from the choices provided ot of

Answers: 2

Answer

Biology, 22.06.2019 06:30

Which statement describes a way in which the digestive and excretory systems work together? a. the nephrons absorb nutrients from food going to the large intestine. b. the excretory system balances blood gases in the small intestine. c. the intestinal villi filter blood and send wastes to the bladder. d. the excretory system balances the salts and water obtained from digested food

Answers: 1

Answer

Biology, 22.06.2019 11:30

Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

I'm a boy and have questions for the girls so here's my list. why r u girls so thicc.???
if t...

Questions