I need help on this question
...
Answers: 2
Biology, 22.06.2019 02:30
Acertain species of fish can have either long or short fins. the allele for long fins is dominant over the allele for short fins. a heterozygous, long-finned fish is crossed with a homozygous, short-finned fish. of the offspring, will have long fins and be , and will have short fins and be .
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:00
Which of the following is not associated with invasive species?
Answers: 1
Biology, 22.06.2019 14:00
Which material is commonly used as a culture medium for living cells
Answers: 2
Mathematics, 15.04.2021 03:50
History, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50
Mathematics, 15.04.2021 03:50