subject
Biology, 22.12.2020 05:50 brien301

What are some examples of scavengers in biology?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 02:30
Variety of living organisms; includes genetic, species, and ecological types.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 19:30
When mitochondrial dna from living relatives was compared with mitochondrial dna from the skeletons, scientisits determined that skeletons 3,4,5,6 and 7 were members of the romanov family. which of these skeletons can be identified by name based on the evidence you have? explain your answer.
Answers: 2
question
Biology, 22.06.2019 23:20
After a signal is transmitted from the eyes through the optic nerve, which part of the brain processes the visual information? a. the limbic lobe b. the occipital lobe c. the frontal lobe d. the temporal lobe
Answers: 1
You know the right answer?
What are some examples of scavengers in biology?...
Questions
question
English, 03.01.2020 11:31
Questions on the website: 13722361