Answers: 2
Biology, 21.06.2019 13:30
Suppose a scientist measures the amount of dna per cell of a particular diploid species at various stages of meiosis. she finds that the meiotic cells contain 3.7 pg , 7.3 pg , or 14.6 pg of dna. match each stage of the cell cycle to the corresponding amount of dna contained within a cell at that stage.
Answers: 3
Biology, 22.06.2019 10:00
Ivan is looking at a cross section of a stem taken from a vascular plant. he sees two different types of vascular tissue: the xylem, which is closer to the center of the stem, and the phloem, located around the xylem, closer to the outside of the stem. how do these two structures work together in a living plant?
Answers: 2
Biology, 22.06.2019 10:00
An animal cell (left) and a plant cell (right) are shown.which organelle, labeled x in the diagram, is found in both plant and animal cells?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which body structures have walls one cell thick...
Mathematics, 10.11.2020 07:00
Mathematics, 10.11.2020 07:00
Advanced Placement (AP), 10.11.2020 07:00
World Languages, 10.11.2020 07:00
Geography, 10.11.2020 07:00
Mathematics, 10.11.2020 07:00
Mathematics, 10.11.2020 07:00
History, 10.11.2020 07:00
Mathematics, 10.11.2020 07:00
English, 10.11.2020 07:00
Mathematics, 10.11.2020 07:00