subject
Biology, 16.12.2020 07:40 pinklavalamp

What type of autopsy is performed on a body that is thought to have died from natural causes?
O1) medical
O 2) forensic
O3) automatic
)4) coroner

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 04:40
Awoman whose sister tested positive for a specific mutation in the brca1 gene, which increases the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of unknown significance near the known mutation site. how should this woman be counseled? select one: a. she should be informed that her risk for breast cancer is greater than the general population but not as great as her sister’s risk. b. she should be informed that because she does not have the mutation, her risk for breast cancer is not greater than that of the general population. c. she should be informed of her gene mutation status and be presented with all the available prophylaxis options and reconstruction options. d. she should be informed that she does not have the specific mutation but that because another mutation is present she should be vigilant about screening
Answers: 1
question
Biology, 22.06.2019 07:10
Me plz he did not infringe upon the policy making powers that he felt the constitution gave congress. but the determination of foreign policy became preponderantly a presidential concern. when the french revolution led to a major war between france and england, washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-british. rather, he insisted upon a neutral course until the united states could grow stronger. which provides the best objective summary of this excerpt? president washington made a good choice when he decided not to accept the recommendations of his advisors and instead insisted that the united states stay neutral during the war between france and england as president, washington believed that the united states should remain neutral in foreign policy even though he had advisors who recommended that he take sides during the war between france and england. washington did not make policy decisions during his presidency because he did not want to interfere with the policy-making powers that the constitution gave congress. washington refused to accept entirely the recommendations of either his secretary of state thomas jefferson, who was pro-french, or his secretary of the treasury alexander hamilton, who was pro-britis
Answers: 1
question
Biology, 22.06.2019 10:00
What are the proteins in connectivity tissues of your foot examples of?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What type of autopsy is performed on a body that is thought to have died from natural causes?
...
Questions
question
Mathematics, 23.10.2020 18:20
question
Chemistry, 23.10.2020 18:20
question
Mathematics, 23.10.2020 18:20
question
Mathematics, 23.10.2020 18:20
Questions on the website: 13722363