Please answer ASAP.
...
Answers: 3
Biology, 21.06.2019 21:30
What was dr. willem johan kolff’s first step in using the scientific process to invent the hemodialysis machine? he built the machine and tried it with various patients, collecting data about its effectiveness. when a patient’s kidneys failed, he wondered if it would be possible to perform kidney functions with an external machine. he researched and collected data about numerous patients who exhibited symptoms of kidney failure. he drew conclusions from studies of various symptoms of kidney failure, and drew a design for the ideal external blood-processing machine.
Answers: 1
Biology, 22.06.2019 08:30
Anormal appearing couple is found to be heterozygous recessive for albinism both have the genotype aa the gene responsible for albinism is recessive to the normal pigment-producing gene what are the changes of their children being albino
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Advanced Placement (AP), 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Chemistry, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Mathematics, 16.01.2021 03:50
Social Studies, 16.01.2021 03:50