![subject](/tpl/images/cats/biologiya.png)
Biology, 15.12.2020 18:40 vanessa5325
Which best describes the storage of the genetic code?
A gene is a segment of DNA, a condensed DNA molecule makes up a chromosome, a chromosome is inside a nucleus, and a nucleus is contained within a cell.
A DNA molecule is a segment of a gene, a gene makes up a chromosome, a chromosome is inside a cell, and a cell is contained within a nucleus.
A gene is a segment of a chromosome, a condensed chromosome makes up a DNA molecule, a DNA molecule is inside a nucleus, and a nucleus is contained within a cell.
A DNA molecule is a segment of a chromosome, a chromosome makes up a gene, a gene is inside a cell, and a cell is contained within a nucleus.
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:00
Free brainliest! what is a characteistic of the american stradfordshire?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
What are examples of the plant life and animal life that can be found in each type of terrarium
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which best describes the storage of the genetic code?
A gene is a segment of DNA, a condensed DNA m...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/es.png)
Spanish, 07.10.2019 15:00
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/fizika.png)
Physics, 07.10.2019 15:00
![question](/tpl/images/cats/mat.png)
Mathematics, 07.10.2019 15:00
![question](/tpl/images/cats/mat.png)
Mathematics, 07.10.2019 15:00
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 07.10.2019 15:00
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
English, 07.10.2019 15:00
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 07.10.2019 15:00
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 07.10.2019 15:00
![question](/tpl/images/cats/istoriya.png)