subject
Biology, 14.12.2020 23:00 mimithurmond03

A pea plant with round seeds (Rr) is crossbred with another pea plant with wrinkled seends (rr). What is the probability of offspring having a wrinkled seed? (4 points) a 0% b 25% c 50% d 75% HURRY TIME LIMIT

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 07:30
The pressurized plants and fungi mentioned in the video have some surprising similarities. what differences would you expect them to have?
Answers: 1
question
Biology, 22.06.2019 08:20
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
question
Biology, 22.06.2019 09:00
This is a typical grassland food web. it is also a small picture of an important cycle on earth: the carbon cycle. describe how the carbon gets into this food web. a) bacteria and fungi, the decomposers, recycle carbon from dead organisms. b) carbon is found in the grass and is passed from one level to the next in this food web. eliminate c) all living things give off carbon dioxide as a by-product of respiration and it is released into the atmosphere. d) plants use carbon dioxide as a reactant in photosynthesis, to make usable chemical energy in the form of a sugar.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
A pea plant with round seeds (Rr) is crossbred with another pea plant with wrinkled seends (rr). Wha...
Questions
Questions on the website: 13722367