subject

Biology, 10.12.2020 07:30 jimenagl

16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand
5' - AACGGTCCAGTCCAAGTTACG - 3

ansver

Answers: 3

Show answers

Another question on Biology

question

Biology, 21.06.2019 16:40

Which hotel do you think is most likely to move ahead in market competition? a. a hotel that provides basic amenitiesb.a hotel that provides luxurious amenitiesc.a hotel that shows understanding of customers' latent needsd.a hotel that gives discounts

Answers: 2

question

Biology, 21.06.2019 20:00

Here's one way to follow the scientific method. place the missing steps in the correct position in the process.

Answers: 3

question

Biology, 21.06.2019 23:30

In iceland, the mid atlantic ridge runs through the center of the contry. what can you conclude about the apperence of iceland many thousands of years from now?

Answers: 2

question

Biology, 22.06.2019 02:30

The idea that all living things are made up of cells is considered scientific law. this means the idea is an emerging scientific idea that has a logical explanation. has been tested with similar results at least twice. is supported by scientific consensus and a large amount of evidence. has been rejected only once by the scientific community

Answers: 1

You know the right answer?

16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direc...

Questions

question

English, 24.03.2021 17:20

1 Which of the following sentences from the story indicates that Joseph has changed? O A. "They may have been scared, but they had...

question

Mathematics, 24.03.2021 17:20

Answer for brainliest ...

question

Business, 24.03.2021 17:20

The selling of Busch Entertainment, a theme park unit that owns SeaWorld, by Belgium-based AB InBev after the acquisition of Anheuser-Busch by InBev t...

question

Physics, 24.03.2021 17:20

The potential difference between the plates of a capacitor is 145 V. Midway between the plates, a proton and an electron are released. The electron is...

question

Biology, 24.03.2021 17:20

Os tecidos, da mesma forma que as células também se agrupam. O conjunto de tecidos que desempenham determinada função recebe o nome de órgãos. Em gera...

question

Physics, 24.03.2021 17:20

How is the displacement graph related to the acceleration graph?...

question

Health, 24.03.2021 17:20

Is it bad to forget past school work?...

question

Mathematics, 24.03.2021 17:20

10. Marco wants to lift no more than 80 pounds with a weightlifting machine. Right now, the machine is set at 20 pounds, and each additional pl...

question

Mathematics, 24.03.2021 17:20

2. Lin missed math class on the day they worked on expanding and factoring. Kiran is helping Lin catch up. a. Lin understands that expanding is using...

question

History, 24.03.2021 17:20

Rate us out of tenwe are true best friends

question

Mathematics, 24.03.2021 17:20

Let's make bags of jelly beans! We have 40 purple and 30 green jellybeans. What is the largest number of identical bags we could make? (Each bag would...

question

Chemistry, 24.03.2021 17:20

If Captain America exerted a force of 50N and Iron Man exerted a force of 65N in the opposite direction, what would the outcome be? What is the net fo...

question

Mathematics, 24.03.2021 17:20

how much will 25 meters of copper wire weigh if 3.4 meters of the same copper wire weighs 0.442 kilograms...

question

Mathematics, 24.03.2021 17:20

8 Two bags, A and B, each contain only green marbles and red marbles. < There are 6 green marbles and 4 red marbles in bag A. Th...

question

Computers and Technology, 24.03.2021 17:20

Display data from the MSC_Product_detail table by performing a Three Table Join with the MSC_Product_detail, MSC_Product_master and MSC_Vendor tables....

question

Mathematics, 24.03.2021 17:20

Solve the equation. You must explain or show your steps for full credit. 3 (x – 5) = 6...

question

Business, 24.03.2021 17:20

White Corporation has entered into an agreement to transfer accounts receivable to Murphy Company. Under the terms of this agreement, White receives 8...

question

Engineering, 24.03.2021 17:20

Your grandmother is concerned about reducing her winter heating bills. Her strategy is to loosely fit rigid polystyrene sheets of insulation over her...

question

Mathematics, 24.03.2021 17:20

Select all the equations that have no solution A. x + 6 = 5 + x B. -2(x - 3) = -2x + 6 C. 4 - 4x = 3x + 2 D. 4(x + 1) = 3(x + 2)

question

Mathematics, 24.03.2021 17:20

What is the surface area of the rectangular prism?

More questions: Biology Another questions

Questions on the website: 13722367