![subject](/tpl/images/cats/biologiya.png)
Biology, 09.12.2020 22:40 alexiaaaa234
Kayla combines a black liquid and a clear liquid. She observes that the two liquids do not mix. Kayla allows the mixture to settle for 30 minutes.
black liquid +
clear liquid
=
clear liquid & black liquid
liquid
Which of the statements below best describes the properties of the two liquids?
- The clear liquid is less dense than the black liquid.
- The clear liquid is more dense than the black liquid.
- The volume of the clear liquid is less than the black liquid.
- The volume of the clear liquid is greater than the black liquid
ps (if you click on the photo, it will be clear)
![ansver](/tpl/images/cats/User.png)
Answers: 1
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:40
Asmall number of finches are removed randomly from the wild and placed in a protected bird area. they are given as much food as they need and have plenty of space. why would natural selection not occur in this population? a. there is no reason for genetic mutation to occur. b. the birds compete for limited resources, c. the population has not reached carrying capacity. d. there is no genetic variation in the finches.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:30
Which of the following is an example of competition a. the leaves of a tree prevent a small shrub from getting sunlight. three species of birds feed a different heights in the same tree. b. three species of birds feed at different heights in the same tree c. zebra and giraffe’s feed on different grassland plants d. cats living in two different homes eat the same brand of cat food.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 21:30
Agriffin is a mythical creature that appears in many stories. it has the head of an eagle and the body of a lion. what role if any could the griffin have in the science of biology
Answers: 2
You know the right answer?
Kayla combines a black liquid and a clear liquid. She observes that the two liquids do not mix. Kayl...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.02.2021 19:00
![question](/tpl/images/cats/health.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mkx.png)
Arts, 03.02.2021 19:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.02.2021 19:10
![question](/tpl/images/cats/mat.png)
Mathematics, 03.02.2021 19:10
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
History, 03.02.2021 19:10
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 03.02.2021 19:10
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 03.02.2021 19:10
![question](/tpl/images/cats/mat.png)
Mathematics, 03.02.2021 19:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 03.02.2021 19:10