Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."

Acceleration is a direct result of a.) balanced forces b.) unbalanced forces c.) gravity d.) velocity

What best explains whether bromine (br) or neon (ne) is more likely to form a covalent bond? bromine forms covalent bonds because it has seven valence electrons, but neon has eight valence electrons and already fulfills the octet rule. bromine forms covalent bonds because it has many electron shells, but neon has only two electron shells and is tightly bound to its electrons. neon forms covalent bonds because it can share its valence electrons, but bromine has seven valence electrons and can gain only one more electron. neon forms covalent bonds because it has only two electron shells, but bromine has many electron shells and will lose electrons in order to fulfill the octet rule.

Up to what percentage of the world's flora consisted of cycads during the triassic period? 100% 75% 50% 20%