Biology, 07.12.2020 02:20 catcatscats122

Which step of Water treatment includes disinfecting water with UV light and Chlorine?
Primary
Secondary
Tertiary (Final)

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 16:20

The use of dna as evidence in criminal investigations became possible because of the

Answers: 3

Answer

Biology, 21.06.2019 20:00

Many people try to eliminate fat from their diets. which is one reason it is necessary for humans to eat fat? a. eating fat is the fastest way to get energy. b. fat eliminates triglycerides from the body. c. saturated fats clear out the blood vessels. d. fat nerves transmit signals. , this is for apex in summer school.

Answers: 1

Answer

Biology, 22.06.2019 11:00

Fill in the blank 1. digestion occurs in the small intestine through the action of enzymes. 2. urea, excess water, and other waste materials are eliminated in a water fluid called 3. can cause infections by injecting dna or rna into hosts. 4. the human immune system produces in response to a vaccine, which later can bind to and destroy a pathogen if it invades. 5. are structures that link bone to bone at a joint 6. in the heart, blood flows from the right atrium to the right ventricle, where it is pumped to the the words i can use are: lymphocytes gliding pivot gas urine absorption dermis fulcrum lungs chemical viruses capillary vertebrae esophagus tendons antibodies synapses ligaments kidneys pathogens

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which step of Water treatment includes disinfecting water with UV light and Chlorine?
Primary...

Questions