Question 7 of 10 What is the product of meiosis |I? O A. Four haploid cells

B. Two diploid cells

C. Two haploid cells

D. Four diploid cells

The process by which natural forces move weathered rock and soil brim one place to another is called

In tomato plants, mendel found that the allele for smooth seeds (s) is dominant, while the allele for wrinkled seeds (s) is recessive. which of these punnett squares shows crosses between two plants heterozygous for smooth seeds? i need this to be answered as soon as ! sry the picture is bad quality

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?